Computer scienceAlgorithms and data structuresAlgorithmsString algorithmsSubstring search algorithms

Boyer-Moore: Bad character rule

Bad character's shortest move

Report a typo

When applying the Boyer-Moore bad character rule to search for the pattern TATTTATT in the sequence GTGGTAATTATTGTGGTAATTATT, what will be the shortest right shift size of the text pointer?

Enter a number

Create a free account to access the full topic